rss
Br J Ophthalmol 83:1296-1299 doi:10.1136/bjo.83.11.1296
  • Scientific correspondence

Detection of cytokine mRNA production in infiltrating cells in proliferative vitreoretinopathy using reverse transcription polymerase chain reaction

Table 1

Number of vitreous and SRF samples that were positive for presence of mRNA for the different cytokines tested

HPRT IL-6 IL1-β TNFα IL-8
Sample
Vitreous (12) (12) 100% (10) 83% (6) 50% (6) 50% (9) 75%
SRF (8) (8) 100% (6) 75% (6) 75% (4) 50% (6) 75%
Total (20) all samples (20) 100% (16) 80% (12) 60% (10) 50% (15) 75%
Controls
MH (10) (5) 50% (2) 20% (1) 10% (0) 0% (1) 10%
RD (6) (6) 100% (2) 33% (0) 0% (1) 16.5% (2) 33%
Total (16) control (11) 68.75% (4) 25% (1) 6.25% (1) 6.255 (3) 18.75%
  • SRF = subretinal fluid, MH = vitreous from macular hole patients, RD = vitreous from retinal detachment patients. Primers used: HPRT 5′GACCAGTCAACAGGGGACAT/3′CGACCTTGACCATCTTTGGA (160 base pairs), IL-6 5′AGGTTGTTTTCT GCCAGTGC/3′CACACAGACAGCCACTCACC (145 base pairs), IL-1β 5′AGCCATGGCAGAAGTACCTG/3′CATCTG TTTAGGGCCATCAG (100 base pairs), TNFα 5′CACCACGCTCTTCTGCCT/3′TCTCAGCTCCACGCCATT (225 base pairs), IL-8 5′AAGAAACCACCGGAAGGAAC/3′TGTGGTCCACTCTCAATCACTC (218 base pairs).

This Article

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of BJO.
View free sample issue >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.