rss
Br J Ophthalmol 2003;87:1046-1048 doi:10.1136/bjo.87.8.1046
  • Letter

Lack of human papillomavirus in pterygium of Chinese patients from Taiwan

  1. K-H Chen1,2,3,
  2. W-M Hsu1,2,
  3. C-C Cheng1,3,
  4. Y-S Li1,3
  1. 1Department of Ophthalmology, Taipei Veterans General Hospital, Taipei, Taiwan
  2. 2National Yang-Ming University, Taiwan
  3. 3Division of Medical Engineering, National Health Research Institutes, Taipei, Taiwan
  1. Correspondence to: Dr Wen-Ming Hsu, Department of Ophthalmology, Taipei Veterans General Hospital, #201, Shih-Pai Road, Section II, Taipei, 11217 Taiwan; khchen{at}vghtpe.gov.tw
  • Accepted 12 December 2002

We read with interest that Gallagher et al had demonstrated the association of human papillomavirus (HPV) and pterygium by polymerase chain reaction (PCR).1 Several hypotheses concerning the pathogenesis of pterygia have been proposed, including exposure to ultraviolet irradiation2 and other environmental factors, genetic predisposition, and viral infections.3 The various theories regarding pterygium formation imply that much about the pathogenesis of pterygia remains to be investigated.

The involvement of HPV in the genesis of pterygia is controversial. Some authors have demonstrated that HPV is present in 24–50% of specimens, whereas others have failed to detect HPV in pterygia.4–7 To help resolve this dilemma, we evaluated 65 pterygia, 23 pinguecula, and 88 normal conjunctiva derived from Chinese patients in Taiwan for the presence of HPV DNA. We used PCR with three different consensus primer sets—MY09/MY11 (MY), L1C1/L1C2-1 (LC), and GP5/GP (GP).

Material and methods

Samples were obtained from consecutive patients treated at the ophthalmological clinic of the Taipei Veterans General Hospital. Medical and ophthalmologic histories were recorded for each patient, a slit lamp microscope examination was performed, and pterygia were photographed before surgery. In each case, a specimen of adjacent clinically normal conjunctival tissue (from the 12 o’clock position of the corneoconjunctival limbus) was obtained. Immediately after surgery, tissue specimens (pterygia, pingueculas, or conjunctival tissues) were stored at −70°C.

DNA preparation

The DNA from specimens was isolated as described previously.8 Briefly, the lysis buffer (10 mM TRIS-HCl; pH 7.5, 1 mM EDTA, pH 7.9; 0.5% SDS) and the proteinase K (100 μg/ml) were added to the specimens and incubated overnight at 37°C. The standard phenol-chloroform extraction and the ethanol precipitation were used for DNA purification and the pelleted DNA was resuspended in 50–100 μl of tridistillated sterile water. To determine the quality and quantity of the isolated DNA, each pelleted DNA sample was analysed by electrophoresis on 1% agarose gels stained with ethidium bromide and viewed spectrophotometrically.

PCR analysis for HPV

Each amplification reaction was carried out in a total volume of 20 μl overlaid with one drop of mineral oil and contained 10 mM TRIS-HCl (pH 8.3), 50 mM KCl, 0.25 U Taq DNA-polymerase (Perkin-Elmer), and 100–200 ng DNA. The concentration of dNTPs and MgCl2 varied with each set of primers. Each PCR was carried out in DNA thermal cycler (Perkin-Elmer CETUS DNA Thermal Cycler 480) with the first denaturation step at 92°C for 4 minutes and the final extension step at 72°C for 15 minutes. The conditions and the number of denaturation-annealing-extraction cycles were different with each set of primers.

To control the quality of the isolated DNA internally, the 268 bp sequence of β globulin gene was amplified using PC04 (5’CAACTTCATCCACGTTCACC3’) primers and GH20 (5′GAAGAGCCAAGGACAGGTAC3′) primers9 in the multiplex PCR with the MY, LC, or GP primers. DNA samples extracted from cell cultures infected with HPV were used as a positive control. Each PCR product was analysed by electrophoresis on 2% agarose gels stained with ethidium bromide.

PCR with MY09 and MY11 consensus primers

The PCR with MY09/MY11 was performed as described previously.10 The PCR methods with the three different sets of primers were described previously.11 The PCR mixture was complemented with 2.5 mM MgCl2, 0.1 mM of each dNTP, 0.5 μM MY09 and MY11 primers (Table 1) and 0.3 μM PC04 and GH 20 primers. The DNA amplication was carried out during 30 cycles that included denaturation at 92°C for 30 seconds, annealing at 53°C for 30 seconds, and primer extension at 72°C for 30 seconds.

Table 1

Consensus primer sequences for human papillomavirus DNA detection

PCR with L1C1, L1C2-1 consensus primers

The PCR with L1C1/L1C2-1 was performed as described previously.10 The PCR mixture was complemented with 4 mM MgCl2, 0.2 mM of each dNTP, 0.5 μM L1C1, and 0.25 μM L1C1–1 primers (Table 1). The DNA amplication was carried out during 30 cycles that included denaturation at 92°C for 30 seconds, annealing at 53°C for 30 seconds, and primer extension at 72°C for 30 seconds.

PCR with GP5, GP6 consensus primers

The PCR with GP5/GP6 was performed as described previously.10 The PCR mixture was complemented with 2.5 mM MgCl2, 0.05 mM of each dNTP, 0.5 μM GP5 and GP6 primers (Table 1) and 0.3 μM PC04 and GH 20 primers. The DNA amplication was carried out during 40 cycles that included denaturation at 94°C for 30 seconds, annealing at 45°C for 30 seconds, and primer extension at 72°C for 30 seconds.

Results

The specimens included 65 conjunctival pterygia, 23 pingueculas, and 88 normal conjunctivas. Characteristics of patients are shown in Table 2. We were unable to detect any HPV DNA fragments in the 23 specimens of pingueculae, 65 specimens of pterygia, and 88 specimens of normal conjunctiva tested.

Table 2

Characteristics of patients with pterygia and pinguecula

Comment

It has been proved that HPV possesses oncogenic potential and contributes to the development of various preneoplastic and neoplastic conditions.12 DNA of many types of HPV, particularly types 16 and 18, has been detected in papillomas, dysplasia, and cancers observed on the eyelids, lacrimal outflow tract, conjunctiva, and cornea.13,14 In this study, three sets of consensus primers, MY, LC, and GP, were used; we were unable to detect HPV in any pterygium, pinguecula, or normal conjunctival specimen from Chinese patients in Taiwan, where the prevalence of pterygia is high.

Three studies have addressed the presence of HPV DNA in pterygia and all used PCR amplification with a single primer (Table 3). These reports demonstrated big differences in frequencies, from 0% to 100%, and variety of HPV types (type 6, 11, 16, 18) that could be possibly explained by the different primers used, the absence of adequate controls, small sample size (10–50 specimens), and the possible different frequencies of HPV infection in geographically distinct populations. Confirmatory larger studies in different geographic populations using more efficient primer(s) are needed to clarify the relation between HPV infection and pterygium formation.

Table 3

Literature reports of human papillomavirus detection in pterygia

The similar controversy occurred in the detection HPV DNA of malignant epithelial neoplasms of conjunctiva but not squamous cell papilloma of conjunctiva.15 By reviewing the published data of previous reports, HPV positive rates in conjunctival papilloma specimens were quite consistent, from 44–75% and most of the HPV types were type 6 and 11 that were classified as low risk HPV genotypes.15 But in the case of malignant epithelial neoplasms of conjunctiva, the frequencies of HPV detection varies from 0–100% and both low risk, HPV-6 and HPV-11, and high risk, HPV-16 and HPV-18, groups were found by various molecular techniques.15

Owing to different populations studied and the absence of a gold standard HPV detection technique and adequate controls in most studies published to date,1,6,7,16 there are marked variations in the obtained HPV prevalence rates in pterygium. Therefore, HPV probably does not act alone in the development of pterygium and the exact role of HPV in the pathogenesis of pterygium remains unclear. The lack of HPV DNA in pterygium in this study may indicate either the HPV is not associated with pterygium formation or that the technique was not adequate for demonstration of such an association. Based on our data, we suggest that HPV is not a required cofactor in the development of pterygia.

Grant support: none.

Commercial relationship: none.

References

This Article

Services

  1. Request permissions

Responses

  1. Submit a response
  2. No responses published

Social bookmarking

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of BJO.
View free sample issue >>

Free archive
The full back archive is now available for BJO. Institutional subscribers may access the entire archive as part of their subscription. Personal subscribers will also have access to all content when logged in. Non-subscribers who register have free access to all articles published before 2006, back to volume 1 issue 1.
Register to access the free archive >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.