rss
Br J Ophthalmol 2009;93:258-262 doi:10.1136/bjo.2008.146639
  • Original Article
    • Laboratory science

Rapid detection and quantification of Propionibacteriaceae

  1. P Goldschmidt1,
  2. C Costa Ferreira2,
  3. S Degorge1,
  4. D Benallaoua1,
  5. S Boutboul3,
  6. L Laroche3,
  7. L Batellier1,
  8. C Chaumeil1
  1. 1
    Laboratoire du Centre National d’Ophtalmologie des Quinze-Vingts, Paris, France
  2. 2
    Hospital S. Sebastiao, Feira, Portugal
  3. 3
    Service 5, Centre National d’Ophtalmologie des Quinze-Vingts, Paris, France
  1. Dr P Goldschmidt, Laboratoire du Centre National d’Ophtalmologie des Quinze-Vingts, 28 rue de Charenton 75012 Paris, France; pablogol{at}aol.com
  • Accepted 15 October 2008
  • Published Online First 31 October 2008

Abstract

Background: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).

Material and methods: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube.

Results: This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.

Conclusion: The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Footnotes

  • Competing interests: None.

This Article

  1. All Versions of this Article:
    1. bjo.2008.146639v1
    2. bjo.2008.146639v2
    3. 93/2/258 most recent

Services

  1. Request permissions

Responses

  1. Submit a response
  2. No responses published

Social bookmarking

Register for free content


Free sample
This recent issue is free to all users to allow everyone the opportunity to see the full scope and typical content of BJO.
View free sample issue >>

Free archive
The full back archive is now available for BJO. Institutional subscribers may access the entire archive as part of their subscription. Personal subscribers will also have access to all content when logged in. Non-subscribers who register have free access to all articles published before 2006, back to volume 1 issue 1.
Register to access the free archive >>

Don't forget to sign up for content alerts so you keep up to date with all the articles as they are published.