Abstract

Background: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).

Material and methods: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube.

Results: This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.

Conclusion: The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.