Article Text

other Versions

Rapid detection and quantification of Propionibacteriaceae
  1. Pablo Goldschmidt (pablogol{at},
  2. Claudia Mora Ferreria,
  3. Sandrine Degorge,
  4. Djida Benallaoua,
  5. Sandrine Boutboul,
  6. Laurent Laroche,
  7. Laurence Batellier,
  8. Christine Chaumeil
  1. Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, France
  2. Hospital S. Sebastiao, Feira, Portugal
  3. Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, France
  4. Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, France
  5. Service 5 - Centre National d'Ophtalmologie des Quinze-Vingts, France
  6. Service 5 - Centre National d'Ophtalmologie des Quinze-Vingts, France
  7. Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, France
  8. Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, France


    Introduction: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Today's methods of diagnosis for Propioni are unsatisfactory due to lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties for interpretation of SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).

    Material and methods: DNA was extracted using the MagNA Pure® isolation kit (Roche) and bacterial detection and quantification was carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). PCR cycling program consisted in one cycle at 95°C, 20 sec and 45 cycles at 95°C, 3 sec and 30 sec at 60°C. DNA extraction yields were assessed in the same tube.

    Results: This test detects as few as 0.01 Equivalent PFU/μl Propioni in PBS, aqueous humor, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.

    Conclusion: The new real time PCR is able to detect 0.01 Eq/CFU µl of Propioni suspended in PBS, vitreous, aqueous humor and human cells in less of 1.30 h.

    Statistics from

    Request permissions

    If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

    Linked Articles

    • At a glance
      Harminder S Dua Arun D Singh