PATIENTS AND METHODS

Participants gave their informed consent, in keeping with European legislation and following a protocol reviewed and approved by supporting institutions. Both groups, 237 subjects from France and 56 from Morocco, had been previously described in detail^7,8; all were Caucasians. In France, they were recruited at the Glaucoma Institute of Saint-Joseph Hospital, the Quinze-Vingts Hospital in Paris, and the Lille University Hospital from 1994–1996. Moroccan patients were living in South Morocco, in the area of Agadir, Taroudant, and Ouarzazate, and were recruited from 1999–2000. Final POAG diagnosis was made at the time of inclusion, after review of inclusion and exclusion criteria (as previously described in detail) and before the genotyping was conducted. The initial IOP was defined as the maximal IOP known before initiation of treatment, usually at the time of diagnosis. All patients were unrelated. The French control group consisted of 110 healthy spouses from GLC1A/MYOC-linked glaucoma families. The Moroccan control sample comprised 60 age matched subjects from the general population of South Morocco.

Genotyping of M98K was performed by PCR-RFLP. The sequence of OPTN exon 5, which encodes this variant, was deduced from the cDNA sequence (Genebank accession number AF420370). Amplification of a 157 bp fragment was carried out with the following primers: forward FAM-5′ggcctggacagagaaacaga 3′ and reverse 5′gctcacctcagatgacctttc 3′, using reagents and conditions previously described,⁹ except that the annealing temperature was set at 62°C. The c603T>A variant, which encodes the M98K amino acid variation, creates an Stu I restriction site; cleavage of the variant polymerase chain reaction (PCR) product with Stu I generated two fragments, of 80 and 77 bp, which were detected after migration on an automated sequencer.

Allele frequencies were compared by assessing 2×2 tables. Distributions of IOP were compared with the nonparametric Wilcoxon–Mann–Whitney test. Pooled data were allowed for stratification according to the population. Exact p values were computed with the StatXact v5 software (Cytel, Cambridge, MA, USA). Because of prior knowledge of an association of M98K with NTG, one sided p values were considered. A similar analysis was also conducted after exclusion of patients who carried a disease causing mutation of the MYOCILIN gene.

RESULTS

Genotyping of the M98K variant of the OPTN gene was performed by PCR-RLFP, exploiting the creation of an Stu I restriction endonuclease site in the variant DNA. As shown in table 1, M98K frequencies in patients and in controls were similar, whether in France or in Morocco. However, there was a significant difference between the two populations, as the frequency of M98K was increased approximately twofold in Moroccan compared with French participants.

Since M98K was associated with glaucoma with normal or moderately elevated IOP,⁶ we investigated an influence of this variant on the initial IOP. There was no selection for or against NTG in the patient samples. The medians were 30 mm Hg (range 14–70 mm Hg) in French patients and 36 mm Hg (range 16–71 mm Hg) in Moroccan patients. As shown in table 2, there was a downward shift of the initial IOP in patients harbouring M98K, in both populations. This shift was significant in the French population only. Moreover, when both samples were pooled, the effect of M98K remained significant. This suggested that the trend observed in Moroccan patients could correspond to a weak effect.

The majority (6/11, 55%) of the French POAG patients positive for M98K belonged to the lower quartile of the distribution of initial IOP (values<25 mm Hg), whereas none was present in the upper quartile of this distribution (values>37 mm Hg). The odds ratio for M98K in the lower compared with the upper quartile was 9.03 (95% confidence interval: 1.25−+∞, p  =  0.013).

The above analysis was performed irrespective of the MYOCILIN gene mutation status. This was to account for the information actually available prior to any genotyping. As reported recently, 17 (7.5%) French patients¹⁰ and one (3%) Moroccan patient⁸ carried a mutation of the coding region of MYOC. In French patients, these mutations were associated with a significantly increased initial IOP. One of the French patients with a MYOC mutation, Q368X, was also positive for the M98K variant. Very interestingly, this double mutant patient had the lowest initial IOP, 23 mm Hg at both eyes, among all MYOC mutation carriers. The other patients who were positive for M98K—that is, excluding the double mutant patient—had a significantly lower IOP than the MYOC mutation carriers (pressure difference < 1×10⁻⁴). Moreover, when they were compared with the patients carrying a normal MYOC gene, the differences in IOP levels remained significant (table 2).

DISCUSSION

Our data indicate that M98K is not a risk factor for POAG by itself. However, at least among French POAG patients, M98K was associated positively with a low initial IOP and negatively with a high initial IOP. Therefore, it can be considered as a modifier of the glaucoma phenotype. This influence of the OPTN gene on IOP is consistent with its expression in the trabecular meshwork.⁶ Alternatively, as OPTN seems to interfere with induction of apoptosis,^6,11 the M98K variant could increase the sensitivity of ganglial neural cells to risk factors of glaucoma. Consequently, in the presence of M98K, a lesser elevation of IOP would be required to damage the optic nerve.

Interestingly, other clinical features were not altered by the presence of M98K. Thus, patients positive or negative for M98K did not differ at diagnosis in age, magnitude of cupping of the optic disc, severity of visual field loss or response to IOP lowering treatments (data not shown).

Despite its low frequency, the M98K variant appears to be present in different Caucasian populations. It will be interesting to investigate this variant in other ethnic groups and also its allelic associations with closely linked polymorphisms to test a common ancestry. The twofold difference observed for M98K prevalence between Moroccan and French populations nevertheless emphasises the importance of assessing the geographical origin of the patients and of matching the controls accordingly.

Additional studies will be necessary to evaluate the usefulness of the M98K variant for the clinical management of POAG patients. However, this variant is confirmed as an interesting marker for investigating the genetic heterogeneity of POAG and for testing phenotype-genotype correlations. It comes in addition to other recently described polymorphisms in the OPA1 and APOE genes, which were associated with NTG or with modification of IOP in POAG patients.^7,12,13 Our data also warrant a detailed analysis of other OPTN gene polymorphisms in POAG patients.