Article Text
Abstract
Aim: To determine the frequency and nature of mutations in the gene ABCA4 in a cohort of patients with bull’s-eye maculopathy (BEM).
Methods: A panel of 49 subjects (comprising 40 probands/families, 7 sibling pairs and a set of three sibs) with BEM, not attributable to toxic causes, was ascertained. Blood samples from each patient were used to extract genomic DNA, with subsequent mutation screening of the entire coding sequence of ABCA4, using single-strand conformational polymorphism (SSCP) analysis and direct sequencing.
Results: Fourteen probands (35%) were found to have a potentially disease-causing ABCA4 sequence variant on at least one allele. Three patients had a Gly1961Glu missense mutation, the most common variant in Stargardt disease (STGD), with 2 of these subjects having a macular dystrophy (MD) phenotype and a second ABCA4 variant previously associated with STGD. The second most common STGD mutation, Ala1038Val, was seen in one patient with cone–rod dystrophy (CORD). Five novel ABCA4 variants were detected. Two sibships were identified with a similar intra-familial phenotype but discordant ABCA4 variants.
Conclusions: Variations in the ABCA4 gene are common in BEM. Two sibships showed discordant ABCA4 variants. One of these sibships illustrates that ABCA4 variants can be identified in families that have another molecular cause for their disease, due to the high prevalence of ABCA4 disease alleles in the population. The discordance evident in the second sibship may yet also be a chance finding in families with macular disease of another genetic cause, or it may represent a complex mode of inheritance determined/modified by the combination of ABCA4 alleles.
Statistics from Altmetric.com
The term bull’s-eye maculopathy (BEM) was first introduced to describe the characteristic appearance of chloroquine retinopathy.1 Bull’s-eye lesions have since been reported in cone dystrophy (COD) and cone–rod dystrophy (CORD),2 rod–cone dystrophy (RCD),3 and several macular dystrophy phenotypes including benign concentric annular macular dystrophy,4 fenestrated sheen macular dystrophy5 6 and MCDR2.7 The pathogenesis of BEM is poorly understood. The characteristic appearance in which there is annular retinal pigment epithelium (RPE) disturbance and central sparing may correspond to the pattern of lipofuscin accumulation in the RPE, which in healthy individuals is highest at the posterior pole but shows a depression at the fovea.8 9 The initially spared centre in BEM usually becomes involved as the disease advances.
We have previously reported the nature and degree of phenotypic variation in a large panel of BEM patients.10 Autofluorescence (AF) imaging findings were used to subclassify subjects into three distinct groups: (1) a ring of increased AF surrounding decreased foveal AF, (2) decreased foveal AF only and (3) a speckled AF pattern.10 11 Patients were also classified as having macular dystrophy (MD), CORD, RCD or COD, on the basis of detailed electrophysiological testing.10
ABCA4 encodes a transmembrane rim protein located in the discs of rod and cone outer segments that is involved in ATP-dependent transport of retinoids from photoreceptor to RPE.12–14 Failure of this transport results in deposition of a major lipofuscin fluorophore, A2E (N-retinylidene-N-retinylethanolamine), in the RPE.14 It is proposed that this accumulation may be deleterious to the RPE, with consequent secondary photoreceptor degeneration.15–17 Recessive mutations in ABCA4 have been identified in Stargardt disease (STGD) and fundus flavimaculatus (FFM),18 RCD19 and CORD.20 Since these phenotypes can be associated with BEM, our panel has been screened to determine both the frequency and nature of mutations in the gene ABCA4 in a cohort of patients with BEM lacking other ophthalmoscopic features of STGD/FFM.
PATIENTS AND METHODS
Patients
A panel of 49 patients (40 families) with BEM, and in whom an acquired toxic aetiology could be excluded, was ascertained. The panel included 8 sibships; 7 sibling pairs and 1 set of three sibs. After informed consent was obtained, blood samples were taken from all individuals for DNA extraction and mutation screening of ABCA4. The protocol of the study adhered to the provisions of the Declaration of Helsinki and was approved by the Ethics Committee of Moorfields Eye Hospital.
Methods
Blood samples from each patient were used to extract total genomic DNA using a Nucleon® Biosciences kit. The entire coding sequence (50 exons), including exon–intron boundaries, of the ABCA4 gene of each patient was screened using single-stranded conformational polymorphism (SSCP) analysis and direct sequencing. Direct sequencing of PCR products was undertaken on an ABI 3100 Genetic Analyser (Applied Biosystems, Foster City, CA), using previously published primer sequences and conditions, in both the PCR and sequencing reactions.18
Subsequently, in the two sets of siblings with concordant phenotypes, but different ABCA4 variants, genotyping was carried out with a CA repeat marker within the coding sequence of ABCA4. In the family from Uganda, the three siblings were genotyped (Cases 1A, 1B and 1C); blood samples were not available from their parents or other family members. In the British family, genotyping was undertaken in the 2 affected brothers (Case 10 and his brother), 2 of their unaffected siblings and both parents. Furthermore, segregation of the identified heterozygous ABCA4 mutation (Ala1038Val) was investigated in this British pedigree.
Genotyping was carried out by utilising a dinucleotide repeat marker that was designed inhouse, HCAREP (HCAREPF: ttctgtcaaagaaccggaaga and HCAREPR: ctggcagtgctgtcagttgt), with the forward PCR primer being fluorescently labelled. PCR reactions were carried in a 25-µl reaction volume, containing 125 ng of DNA, 1× NH4 buffer (Bioline™), 1 mM MgCl2, 200 µM each dNTP, 2.50 pmol each of forward and reverse primer and 1U BioTaq. The thermocycling profile used consisted of an initial denaturation of 4 min at 95°C, immediately followed by 35 cycles of 95°C for 15 s, 61°C for 30 s and 72°C for 30 s, with a single final extension step of 72°C for 5 min. PCR products were diluted and denatured in formamide and size-fractionated using an ABI 3100 Genetic Analyser. PCR products were automatically sized by the 3100 Data Collection Software version 1.0.1 program using ROX as the size standard and scored using the GeneMapper version 2.0 program.
RESULTS
Subjects were divided according to AF imaging findings and electrophysiological assessment (table 1). Patients in the panel were identified as having 1 of 3 AF imaging patterns: (1) a ring of increased AF surrounding decreased foveal AF, (2) decreased foveal AF only, and (3) a speckled AF pattern. Patients were also classified as having MD, CORD, RCD or COD, on the basis of detailed electrophysiological testing. All 3 AF patterns and all 4 electrophysiological phenotypes were found to be associated with ABCA4 variants, with MD being the most common (64%) (table 1).
Fourteen probands (35%) were found to have a potentially disease-causing ABCA4 sequence variant on at least one allele (table 1). In 4 of these subjects (29%), both mutations were identified (Gly1961Glu/Cys1490Tyr, Gly1961Glu/Asn965Ser, IVS38-10T>C/Cys2150Tyr, Gln2238Stop/Gly1961Glu); with the second allele not being characterised in the remaining 10 patients. It is likely that IVS38-10T>C represents a non-disease-causing variant, although it is believed to label an ABCA4 disease-associated allele.21 Sixteen sequence variants were identified in the panel, consisting of 13 missense variants, 2 nonsense mutations and 1 splice-site variant. Three patients had a Gly1961Glu missense mutation, the most common variant in STGD, with 2 of these subjects having a macular dystrophy phenotype and a second ABCA4 variant previously associated with Stargardt disease (fig 1). The second most common STGD mutation, Ala1038Val, was seen in one patient with CORD. Five previously unreported ABCA4 variants were detected; three missense mutations (Val552Ile; (GTA>ATA), Ala538Asp; (GCC>GAC), Arg508Cys; (CGG>TGC) and two truncating nonsense variants (Gln2238Stop; (CAG>TAG), and Leu661 ins1 ctG; (Stop (TAG) at codon 765).
Two sets of siblings with concordant phenotypes but different ABCA4 variants were identified (fig 2). The first set of siblings originated from Uganda, comprising two sisters and a brother, with the brother (fig 3) and younger sister being heterozygous for the missense mutation Leu1201Arg, and the eldest sister harbouring a heterozygous 1bp insertion in codon 661 (fig 4). Their parents have been unavailable for clinical examination and molecular genetic testing; however, both mother and father are reported to be entirely asymptomatic with good vision at ages 61 and 80 years, respectively. Genotyping findings (fig 4) are consistent with the sequencing data that identified 2 siblings harbouring the Leu1201Arg mutation (on allele 4) and the third sibling having a different 1-bp insertion variant (on allele 6). Forensic markers have been used to demonstrate that these individuals are full siblings (data not shown, Ed Stone). This intra-familial discordance of ABCA4 variants may be a chance finding in families with macular disease of another cause or may represent a complex mode of inheritance determined/modified by the combination of ABCA4 alleles.
The second set of siblings with concordant phenotypes but different ABCA4 variants are 2 British brothers, with the elder brother being heterozygous for the common substitution Ala1038Val, but the younger brother was not found to harbour an ABCA4 variant (fig 5). Their parents were examined clinically and were found to have normal vision and fundus appearance. In contrast to the Ugandan family, the presence of parental segregation data and genotyping findings (fig 5) suggest that ABCA4 is not the disease-causing gene in this family. The affected brothers share no alleles by descent, from the intronic CA repeat marker segregation analysis. Allele 3 identifies the proposed disease-causing maternal chromosome harbouring the mutation Ala1038Val, and only one affected son has inherited this maternal chromosome. X linked inheritance remains a possibility in this family.
DISCUSSION
We have demonstrated that variations in the ABCA4 gene are common in a large carefully ascertained panel of patients with bull’s-eye maculopathy, with a third of patients harbouring potentially disease-causing mutations. This finding also suggests that BEM is genetically heterogeneous, in keeping with other clinically defined inherited retinal disorders, including COD, CORD, RCD and ARMD.2 28 While heterogeneity diminishes the value of a negative result following mutation screening, it does not lessen the value of a positive result.
Two sibships (two British brothers, and two Ugandan sisters and a brother) showed discordant ABCA4 variants, despite a highly concordant intrafamilial phenotype. The British sibship illustrates that ABCA4 variants can be identified in families that have another molecular cause for their disease. This is primarily due to the high prevalence of disease-associated alleles in the population (∼1 in 50) and the polymorphic nature of the gene, thereby suggesting that caution should be exercised when counselling families. Furthermore, this family also demonstrates that the Ala1038Val variant, when not co-inherited with Leu541Pro, may not label a disease chromosome. In the Ugandan family, this discordance may be an epiphenomenon, in families with macular disease of another cause, or may represent a complex mode of inheritance determined by the combination of ABCA4 alleles. It is possible that digenic inheritance may prove to explain the observations in this sibship, as is seen in an unusual form of retinitis pigmentosa, in which mutations of the peripherin/RDS gene and ROM1 (rod outer segment protein 1) gene are present within the same family.22 Individuals with a mutation of one gene but not the other are clinically unaffected. Affected individuals are double heterozygotes, with mutations of both ROM1 and peripherin/RDS.
Five novel ABCA4 variants have been identified; three missense mutations and two truncating nonsense variants. The presence of the STGD-associated Gly1961Glu variant in three BEM patients may suggest that both disorders share a common molecular pathology, but that the macular appearances are modified by other genetic or environmental factors. The characterisation of these modifying factors represents an important challenge in retinal genetics, for, while our understanding of the underlying molecular basis of inherited retinal disorders has improved dramatically over the last decade, these insights have been accompanied by a growing realisation of the complexity of retinal disease. It is increasingly recognised that different mutations within the same gene may produce different clinical phenotypes (phenotypic heterogeneity). However, the same mutation in different individuals, even within the same family, may also produce different clinical consequences (clinical heterogeneity). Furthermore, mutations in different genes may cause the same retinal disease (genetic heterogeneity); with many different disease-causing mutations often identified in these genes (allelic heterogeneity).
ABCA4 encodes a transmembrane rim protein (an outwardly directed flippase of all-trans retinal), located in the discs of rod and cone outer segments, that is involved in ATP-dependent transport of retinoids from photoreceptor to RPE during the visual cycle.12–14 Recessive mutations in ABCA4 have been identified in STGD/FFM,18 RCD19 and CORD.20 It is currently believed that: (1) homozygous null mutations cause the most severe phenotype of autosomal recessive retinitis pigmentosa (RP, RCD), (2) combinations of a null mutation with a moderate missense mutation result in autosomal recessive CORD and (3) combinations of null/mild missense or two moderate missense mutations cause STGD/FFM.23
The high allelic heterogeneity of ABCA4 is clearly demonstrated by the fact that approximately 500 sequence variations in this gene have been reported. This highlights the potential difficulties in definitively assigning disease-causing status to sequence variants detected when screening such a large (50 exons) and polymorphic gene. Nonsense mutations that can be predicted to have a major effect on the encoded protein can be confidently predicted to be disease-causing. However, a major problem occurs with missense mutations, since sequence variants are common in controls (carrier frequency 1 in 50), and therefore establishing pathogenicity may be problematic. Large studies assessing whether particular sequence variants are statistically more frequently seen in STGD patients than controls are thereby likely to be helpful.21 Direct evidence of pathogenicity can be established by functional analysis of the encoded mutant ABCA4 transporter protein, with either severely reduced ATPase activity associated with many variants, including Gly1961Glu,24 or protein mislocalisation with retention of mutant ABCA4 in the photoreceptor inner segment, identified in several ABCA4 mutants, including those harbouring the Ala1038Val substitution.25 The availability of multiple independent families with the same mutation may also provide evidence in support of disease causation.
Failure of the ABCA4 transporter protein results in deposition of a major lipofuscin fluorophore, A2E, in the RPE.14 It is proposed that this A2E accumulation may be deleterious to the RPE via the generation of DNA-damaging epoxides,15–17 with consequent secondary photoreceptor degeneration. The antioxidants vitamins E and C have been shown to reduce A2E epoxidation, with a corresponding reduction in DNA damage and cell death.15 Studies with the abca4−/− knock-out mouse have established two further potential strategies of reducing A2E-related toxicity by inhibiting the formation of such lipofuscin pigments; the first being to reduce light exposure (suggesting that wearing dark tinted spectacles may be beneficial),26 and the second via the use of the pharmacological agent isotretinoin (13-cis-retinoic acid).27
We have shown that screening of ABCA4 should be considered in patients with BEM, since a third of subjects are likely to harbour potentially disease-causing mutations in this increasingly well-characterised gene and its protein product. The identification of subjects with ABCA4 mutations may prompt the clinician to consider counselling the patient regarding the potential benefits of avoidance of excessive light exposure. Furthermore, a molecular genetic diagnosis will allow pharmacological or gene-directed therapies, likely to become available in the near future, to be offered to appropriate patients.
Acknowledgments
We are grateful to the patients who kindly agreed to take part in this study.
REFERENCES
Footnotes
Competing interests: None declared.
- Abbreviations:
- AF
autofluorescence
- BEM
bull’s-eye maculopathy
- COD
cone dystrophy
- CORD
cone–rod dystrophy
- FFM
fundus flavimaculatus
- MD
macular dystrophy
- RCD
rod–cone dystrophy
- RPE
retinal pigment epithelium
- SSCP
single-strand conformational polymorphism
- STGD
Stargardt disease
Linked Articles
- BJO at a glance