Article Text

Download PDFPDF
Rapid detection and quantification of Propionibacteriaceae
  1. P Goldschmidt1,
  2. C Costa Ferreira2,
  3. S Degorge1,
  4. D Benallaoua1,
  5. S Boutboul3,
  6. L Laroche3,
  7. L Batellier1,
  8. C Chaumeil1
  1. 1
    Laboratoire du Centre National d’Ophtalmologie des Quinze-Vingts, Paris, France
  2. 2
    Hospital S. Sebastiao, Feira, Portugal
  3. 3
    Service 5, Centre National d’Ophtalmologie des Quinze-Vingts, Paris, France
  1. Dr P Goldschmidt, Laboratoire du Centre National d’Ophtalmologie des Quinze-Vingts, 28 rue de Charenton 75012 Paris, France; pablogol{at}


Background: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).

Material and methods: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube.

Results: This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.

Conclusion: The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Statistics from


  • Competing interests: None.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

Linked Articles

  • At a glance
    Harminder S Dua Arun D Singh