Article Text

Download PDFPDF

RPGR ORF15 genotype and clinical variability of retinal degeneration in an Australian population
  1. J B Ruddle1,2,
  2. N D Ebenezer3,
  3. L S Kearns1,
  4. L E Mulhall2,
  5. D A Mackey1,2,
  6. A J Hardcastle3
  1. 1
    Centre for Eye Research Australia, East Melbourne, Australia
  2. 2
    Ocular Diagnostic Clinic, Royal Victorian Eye and Ear Hospital, East Melbourne, Australia
  3. 3
    UCL Institute of Ophthalmology, London, UK
  1. Correspondence to Dr J Ruddle, Centre for Eye Research Australia, 32 Gisborne St, East Melbourne 3002, Australia; jbruddle{at}gmail.com

Abstract

Background: Mutations in the retinitis pigmentosa GTPase regulator gene (RPGR) are estimated to cause up to 20% of all Caucasian retinitis pigmentosa and up to 75% of cases of X-Linked RP (XLRP). Exon open reading frame 15 (ORF15) is a purine-rich mutation hotspot. Mutations in RPGR ORF15 have also been documented to cause X linked cone–rod dystrophy (XLCORD) and atrophic macular degeneration at an unknown frequency.

Methods: From a hospital clinic population, probands with probable XLRP and XLCORD were screened for RPGR ORF15 mutations and fully phenotyped.

Results: Four different RPGR ORF15 mutations were found in four probands. All mutations in the ORF15 exon resulted in premature truncation of the RPGR protein. Three were nonsense mutations: c.507G>T (p.E169stop), c.867G>T (p.G289stop), c.897G>T (p.E299stop) and the fourth a single nucleotide insertion c.1558–1559insA (p.S522fs 525stop). One family exhibited typical XLRP, two XLCORD and one a combination of the phenotypes.

Conclusion: RPGR ORF15 mutations produce intrafamilial and interfamilial clinical variability with varying degrees of cone degeneration. In an Australian clinic population RPGR ORF15 mutations cause XLCORD in addition to XLRP.

Statistics from Altmetric.com

Retinitis pigmentosa (RP) is a group of progressive photoreceptor degenerations that are clinically and genetically heterogeneous (OMIM 268000). The overall incidence is estimated at one in 4000 in the general population.1 X linked RP, a severe subtype of RP, accounts for approximately 9% of RP in an Australian clinic population.2 It typically manifests as night blindness in the first two decades and then leads to progressive visual-field loss causing blindness by the third or fourth decade in affected men.

The two known RP genes among five loci on the X chromosome are designated RPGR (OMIM 312610) and RP2 (OMIM 312600). Together these loci account for most cases of XLRP: RPGR (RP3) 70–75% and RP2 11–25%. Data from other studies have revealed that mutations in the RPGR gene may account for 15–20% of all cases of RP in Caucasians.3

RPGR is ubiquitously expressed, and its retinal photoreceptor isoform contains a large 3′ terminal exon, termed ORF15. This exon contains a purine-rich repetitive region that codes for a 567 C-terminal domain rich in glutamic acid and glycine residues. Exon ORF15 was found to have mutations in 60% of XLRP of families of mainly British and Irish descent.4 The majority of the mutations have been found in the 5′ purine-rich sequence of ORF15.3 4 5

Cone or cone–rod dystrophy (COD or CORD) is a progressive retinal dystrophy which typically presents with decreased acuity, poor colour vision, central scotomata and photophobia. With time, rod system abnormalities may also feature.6 Mutations in RPGR have been shown to cause X linked cone dystrophy with or without later rod involvement7 8 9 10 and X linked macular atrophy.11 Interestingly, all the mutations in RPGR to date causing predominantly early macular or cone dysfunction are found in ORF15. In this study, we investigated families with a range of X linked retinal degeneration phenotypes including predominant cone dysfunction phenotypes, for RPGR ORF15 mutations.

Methods

Clinical method

Following local ethics committee approval probands were identified from the Ocular Diagnostic Clinic at the Royal Victorian Eye and Ear Hospital. After informed consent, clinical information on age at symptom onset, visual acuity, Goldmann visual field (IV4e target), colour vision (Ishihara plates) and family history were obtained. Results of dark adaptometry testing and electroretinograms (ERG) where possible were collected prospectively, though for some subjects we relied on chart review.

Laboratory method

After extraction of genomic DNA from peripheral blood leucocytes, the entire ORF15 open reading frame of 1706 bp was amplified from a male proband as one product (1786 bp) with the primer pair ORF15F 5′-GTATGATTTTAAATGTGATCGCTTGTCAGAG-3′ and ORF15R 5′-AAGGCATTTAAATTGTCTGACTGGCCATAATC-3′. A 50 μl PCR reaction contained 100 ng of DNA, 1 μM of forward and reverse primers, 25 μl ReddyMix (AB-0795, ABgene, UK) and PCR amplification was performed at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 56°C for 30 s 72°C for 1 min 30 s, followed by one cycle of 72°C for 5 min. The resultant amplicon was then purified using a Qiagen column following the manufacturer’s protocol (Promega, Madison, Wisconsin). The purified PCR product was then directly sequenced and run on an ABI 3100 (Applied Biosystems, Foster City, CA) following the manufacturer’s protocols with four specific primers as follows; 624F AGGAGAGGAAGAAGGAGACC using dGTP BigDye Terminator (ABI), 746F AAGAGGAAGAGGAGGAGGGT using dGTP BigDye Terminator (ABI), 1110R TCCTCCTCTTCCCCCTCCCA using 3.1 BigDye Terminator (ABI), 1326R CTTCCACCTCCCCTTCCACTT. If bidirectional coverage of ORF15 was not achieved using the protocol described above, either additional primers were used for sequencing (available on request) or the 1786 bp PCR product was cloned into the pGEM-Teasy vector, propagated (Promega) and DNA extracted (GenElute mini prep kit; Sigma-Aldrich, Poole, UK) according to the manufacturer’s instructions. The cloned ORF15 insert was then sequenced using the primers described above and additional M13 vector primers. Sequences were analysed using Lasergene software and compared with the reference sequences for ORF15 and RPGR.

Results

RPGR ORF15 mutations

Screening probands with probable XLRP or XLCOD/XLCORD revealed RPGR ORF15 mutations in four families (table 1). One ORF15 mutation was identified in a family diagnosed as having both XLCORD and XLRP. Three were nonsense mutations: c.507G>T (p.E169stop), c.867G>T (p.G289stop), c.897G>T (p.E299stop) and the fourth a single nucleotide insertion leading to a frameshift c.1558–1559insA (p.S522fs 525stop). All the mutations result in a premature stop codon predicted to prematurely truncate the RPGR protein. Three novel mutations were identified.

Table 1

RPGR ORF15 mutations and associated phenotypes

Clinical results

Family pedigrees in which mutations were identified are illustrated in fig 1A–D.

Figure 1

Australian pedigrees (A–D) diagnosed as having XLRP or XLCORD. Filled squares indicate affected males, open squares unaffected males. Open circles are females, and obligate carrier females or clinically affected females are indicated by circles with dots.

Family A

The proband (III-1) was seen, aged 32 and diagnosed as having cone–rod dystrophy. His corrected central vision was 6/60 bilaterally, near vision N10 and colour vision very poor. Visual fields showed paracentral scotomata with superior breakthrough. He was a high myope R −9.00DS, −7.50DS. Fundus examination revealed atrophic central and inferior changes. Inheritance was thought to be X linked, as his grandfather had poor vision particularly from his 40s; there were no other affected family members.

Family B

This family features three affected males (two brothers and a cousin) who were all seen in their 30s, with symptoms dating back to early childhood. The proband (IV-2) aged 31 wearing R −10.25DS, L −9.75DS had vision of R 6/48, L 6/38 and poor colour discrimination. His field revealed central scotomata with normal peripheral extent. Dark adaptometry thresholds were normal. The presentation was similar in his older cousin aged 37 (IV-5), also a high myope (R −12.00DS, L −13.00DS) with vision of 6/48 bilaterally, and both patients were diagnosed as having cone–rod dystrophies; their fundi are shown in fig 2A,B. The other younger brother (IV-7) had a picture consistent with RP at 30 (fig 2C) with vision of R 6/9, L 6/12 (R −11.00DS, L −11.00DS) with a preserved central field of only 20° around fixation with no peripheral field islands. All three had flat photopic ERGs and less than 50% residual scotopic response.

Figure 2

Retina photographs showing intrafamilial phenotype variability for family B. (A) Male proband (IV:2) and (B) his male cousin (IV:5) both myopic with XLCORD, showing retinal atrophy centrally and along the arcades. (C) Another cousin (IV:7), also myopic with preserved central macula, peripheral pigment and attenuated arterioles consistent with XLRP. (D) Carrier female (III-2) exhibiting striking retinal flecks as a teenager.

The mother of the proband (III-2) reported delayed dark adaptation since childhood and small scotomata from 15 to 50° that disrupted reading in her 30s. Her fundus exhibited golden flecks, striking from age 12 (fig 2D) but decreased and mottled at her most recent examination in her 40s. At this time, ERG also showed greater cone dysfunction than rod dysfunction, but central vision remained 6/5 and colour vision intact.

Family C

The proband (III-1) exhibited classic RP with night blindness from his mid teens, though central vision enabled him to drive until aged 23. Examined aged 45, he had only 5° of central field, with 6/36 vision in both eyes and refraction of R −1.75DS, L −1.00DS. His fundus showed widespread atrophic changes with minimal pigmentation. Electrophysiological testing showed no retinal response. His deceased mother had symptomatic night blindness, and his maternal uncle was said to be blind from 12. His only affected living relative, a nephew, was not available for examination.

Family D

One of four brothers reportedly affected by Stargardt disease was examined along with his affected maternal cousin and nephew. None of the carrier females reported any vision problems, and with predominantly central vision disturbance, X linked cone–rod dystrophy was diagnosed. Aged 53, the proband (III-2) had vision of R 6/9 L 6/6. His colour vision was poor, and he had raised thresholds on dark adaptometry. A midperipheral scotoma was present in his visual field. Fundus examination revealed an atrophic macula (fig 3A). ERG testing showed flat photopic traces, and low normal amplitudes for his scotopic tests.

Figure 3

Retina photographs showing variability of family D with X linked cone dystrophy. (A) Male proband (III-2) with good central vision but paracentral macular atrophy. (B) Male cousin (III-9) with poor central vision and confluent central macular atrophy (III-9). (C) Younger nephew in his 30s IV-4 showing more subtle central macular change.

His male cousin (III-9 fig 3B) experienced his first symptoms in his 20s. Aged 50 wearing R −7.50DS, L −7.00DS, he had only 6/120 central vision. He had minimally preserved amplitudes on photopic ERG and normal amplitudes on scotopic ERG. This outer retinal function was confirmed with normal extent of peripheral field and normal dark adaptation threshold sensitivity.

The proband’s nephew (IV-4) first had central vision disturbance from his 20s. Aged 35, his vision was R 6/30, L 6/38 wearing R −0.50DS, L −1.00DS, with poor colour vision. His field showed normal peripheral extent, but due to rapid saccades it was not possible to find a central scotoma or physiological blind spot. ERG scotopic amplitudes were 75% of normal, photopic were 30% of normal, and flicker response was abolished. His fundus showed central atrophic area (fig 3C), coinciding with macular thinning on OCT.

Discussion

From a tertiary referral clinic population, a high proportion of Australian X linked families found to have an RPGR ORF15 mutation have a diagnosis of XLCORD (three of four) suggesting that RPGR ORF15 should be the first gene and exon screened in families with this presentation.

Moderate to high myopia was a particular feature in these pedigrees, especially those dominated by cone dysfunction (families A, B and D), a finding previously noted in XLCORD.10

In family B, the phenotype was strongly associated with high myopia, and of the three men in their 30s, two had cone–rod loss with central scotomata and poor acuity, while the other presented with outer rod dysfunction and preserved central vision. Intrafamilial phenotypic heterogeneity has previously been described in non-identical twins that shared the same RPGR deletion, as one brother had classical XLRP and the other a cone–rod phenotype.12 Here, we further describe this intrafamilial phenotypic heterogeneity.

The mutation (c.897G>T) in family C has been previously reported to cause XLRP in two patients4 (https://rpgr.hgu.mrc.ac.uk). The other three mutations reported here, c.507G>T, c.867G>T and c.1558–1559insA, are novel.

It has been suggested that mutations located 3′ to the highly repetitive region of RPGR ORF15 are associated with cone–rod degenerations rather than classic RP, and the majority of studies have supported this observation.9 7 10 13 Consistent with this genotype/phenotype correlation, our most 3′ mutation in family D presented with a cone dominant picture, including three of the brothers of this family (not available for examination) being labelled with Stargardt macular dystrophy in the 1980s (III-1, III-4, III-7). Against this genotype/phenotype correlation was the fact that our patient with c.507G>T missense mutation and other reported relatively 5′ mutations presented with early cone or predominantly cone involvement.4 9 In general, there are far fewer patients reported with RPGR ORF15 linked cone dystrophy than those with XLRP making phenotype–genotype conclusions difficult.

Our findings detail genotype and phenotype in affected males. Only one symptomatic carrier female (family B III-2) was examined as reported above. Further work documenting longitudinal change of carrier phenotypes is needed.

This study has further shown that broad clinical variability is a hallmark of RPGR-ORF15 X linked retinal disease. Clinicians should be alert in identifying possible X linked families anywhere on the spectrum from typical RP to typical cone dystrophy and those with a mixed picture of photoreceptor involvement. These individuals should be referred for genetic counselling and tested for ORF15 RPGR mutations. Further research is needed to clarify the role of RPGR in rod and cone photoreceptor dysfunction, and to find genetic and/or environmental modifiers of the disease.

Acknowledgments

We thank all the families for participating in this study.

REFERENCES

Footnotes

  • Funding This research was supported by grant 065454/Z/01/Z from the Wellcome Trust.

  • Competing interests None.

  • Provenance and Peer review Not commissioned; externally peer reviewed.

  • Ethics approval Ethics approval was provided by the Royal Victorian Eye and Ear Hospital, Melbourne.

  • Patient consent Obtained.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.