Article Text

Download PDFPDF

Postoperative endophthalmitis due to Burkholderia cepacia complex from contaminated anaesthetic eye drops
  1. Prajna Lalitha1,
  2. Manoranjan Das2,
  3. Patwari S Purva3,
  4. Rajaratinam Karpagam1,
  5. Manoharan Geetha1,
  6. Jeganathan Lakshmi Priya1,
  7. Kannan Naresh Babu3
  1. 1Department of Ocular Microbiology, Aravind Eye Hospital, Madurai, India
  2. 2Department of Cornea and Refractive Surgery, Aravind Eye Hospital, Madurai, India
  3. 3Department of Retina, Aravind Eye Hospital, Madurai, India
  1. Correspondence to Dr Prajna Lalitha, Aravind Eye Hospital, 1 Anna Nagar, Madurai, Tamil Nadu 625 020, India; lalitha{at}aravind.org

Abstract

Objective To report the clinical presentation and outcomes of cluster postcataract Burkholderia cepacia complex endophthalmitis, the source of infection and clonal relatedness of the isolates.

Methods This was a retrospective study on 13 patients who developed acute postoperative endophthalmitis, along with an infiltrate at the corneal section, after an uneventful cataract surgery with intraocular lens implantation. Aqueous aspirates, vitreous aspirates and environmental surveillance specimens were sampled. Genotypic diversity was determined by PCR using BOX-PCR for each strain, and the clonal relationship was established between clinical and eye drops isolates.

Results Vitreous samples showed B. cepacia in cultures in all 13 eyes. Among the samples from various surveillance specimens cultured, topical anaesthetic eye drops grew B. cepacia. The isolates from the patients and the eye drops solution revealed matching banding patterns in BOX-PCR. Isolates from the patients and eye drops were susceptible to cefotaxime and piperacillin/tazobactam only. 9 (69%) patients out of 13 had a final visual acuity of 6/60 or better. Among the remaining four patients, three had a vision of perception of light and one had final vision of 1/60.

Conclusions Microbiology culture and BOX-PCR results revealed contamination of local anaesthetic eye drops and the same organism was cultured from a group of patients with acute-onset postoperative endophthalmitis after an uneventful cataract surgery. Outbreaks may occur in the most vigilant settings, and any sterile consumable may be a common link.

  • Microbiology
  • Infection

Statistics from Altmetric.com

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.

Introduction

Postoperative endophthalmitis is a potentially devastating complication following intraocular surgery. It often occurs sporadically, and in such situations, the common source of infection is thought to be from the conjunctival flora of the patient.1 Rarely, cluster infections can also occur due to exogenous sources and have been reported due to contaminated surgical supplies and consumables like contaminated intraocular lenses, trypan blue or irrigating fluids.2–4 While Pseudomonas sp. are the most common causative organisms implicated in cluster infections, other organisms like Stenotrophanomas sp. are also reported.5 ,6 In a recent systemic review of endophthalmitis outbreaks following cataract surgery, it was found that the two most common causes associated with the outbreaks were contaminated solutions and contaminated phacoemulsification machines and that Pseudomonas aeruginosa was the common causative bacteria in the majority of the reports.7

The Burkholderia cepacia complex (Bcc) is a multispecies complex of bacteria that commonly causes respiratory infections in persons with cystic fibrosis.8 ,9 It is the most common organism associated with contamination of sterile pharmaceutical products like contaminated nasal sprays, ultrasound gel, mouthwash and nebulisation solution.10–15 Although not common, Bcc can also cause acute postoperative endophthalmitis following cataract surgery.16

Here, we report a cluster infection caused by an unusual organism, Bcc, and with an unusual presentation. We also describe the outcome of its epidemiological investigation and report contamination of local anaesthetic eye drops as a new source of infection. We furthermore have analysed the clinical presentation and the clonal relatedness of the isolates from the patients and the eye drop bottles.

Materials and methods

Patients who developed endophthalmitis following cataract surgery done from a single institution over a 3-month period were analysed. The approval of the Institutional Ethics Committee of Aravind Eye Hospital was obtained for the retrospective analysis.

The patients at the time of presentation were examined by a retina specialist. Indirect ophthalmoscopy followed by ultrasound examination was done, which confirmed the presence of endophthalmitis. Endophthalmitis was defined as patients who presented with pain, congestion and defective vision with ultrasonography revealing vitreous exudates and thickening of the retina-choroid complex. The same criteria were used for all patients as indication for doing vitrectomy.

Intravitreal antibiotic injection followed by a core vitrectomy was done for each patient. Silicone oil was injected in all the patients to act as a barrier and prevent the organism from growing in the vitreous medium. This was removed at the end of 6 months. Once B. cepacia was identified as the causative organism from the vitreous samples, intravitreal piperacillin and tazobactam combination was injected at the time of vitrectomy. Topical vancomycin and topical chloramphenicol dexamethasone (1%) eye drops were used four times a day. Additionally, all 13 patients had a corneal tunnel infiltrate that appeared either at the time of presentation or during the course of treatment. A patch graft was done for all these patients after excising the infected cornea. This was done after 2 or 3 months of the persistence of the infiltrate in the hope of removing the focus of infection.

For each patient, an undiluted vitreous sample was collected before starting vitrectomy and sent to the microbiology laboratory in a sterile container. The vitreous sample underwent microbiological analysis and Burkholderia sp. was identified, which was further confirmed using the API ID 32GN (Biomerieux) system database as commercial identification systems have been shown to be capable of identifying Bcc reliably.17–19 Antibiotic susceptibility to amikacin, ofloxacin, levofloxacin, cefuroxime, gentamicin, tobramycin, ceftazidime, cefotaxime, gatifloxacin, moxifloxacin, ciprofloxacin, piperacillin, tazobactam and chloramphenicol was tested using the agar disk diffusion (Kirby-Bauer) method according to the Clinical And Laboratory Standards Institute (CLSI) guidelines.20

After this, an outbreak was suspected and investigations were carried out in the concerned hospital operating room in order to identify the source of infection. The data collected included the number of cataract surgeries performed during the outbreak, demographic information, eye affected, type of cataract surgery, type of intraocular lens implanted, presenting signs and symptoms, time between cataract surgery and diagnosis of endophthalmitis, information regarding specimens sent for culture, smear and culture report and antibiotic susceptibility, treatment advocated and visual and anatomic outcomes at final follow-up.

Surveillance was performed to identify the cause, and microbiological analysis was performed on surveillance samples obtained from the internal tubes of the phacoemulsification machines, the povidone-iodine solution, local anaesthetic eye drops, the irrigation solutions (Ringer's lactate and balanced salt solutions), viscoelastic devices, trypan blue and intracameral adrenaline of the same batches used for the surgery. Samples were also collected from the operating microscopes, surfaces of operating tables, instrument trolleys, air conditioning system of the operating rooms, water used for scrubbing and intraocular lenses from the same lot.

Genotyping of bacterial isolates by BOX-PCR

After confirmation with the API system, two of the isolates, one from the patient and one from the eye drop bottle, were further confirmed by sequencing as B. cepacia. The sequenced isolate was used as the positive control in the BOX-PCR. The sequence was submitted in the GenBank.

Bacterial genomic DNA was extracted from all the isolates of Bcc using a Qiagen DNA extraction kit. Box elements are repetitive sequence elements in bacterial genomes; single PCR primers targeting the repeats can be used to fingerprint bacteria species. Rep-PCR typing with a BOX-A1R primer (5′CTACGGCAAGGCGACGCTGACG 3′) was done according to the protocol of Coenye et al.21 To check for variations between PCR, the experiments were repeated thrice with duplicates for each isolates with same concentration of DNA being used for each PCR reaction.

Results

The patients reported in this study underwent uneventful phacoemulsification procedure with implantation of an acrylic foldable intraocular lens in a private clinic by a single surgeon. The surgeries were performed under topical anaesthesia from December 2011 to February 2012. When these patients developed signs of endophthalmitis, they were referred to Aravind Eye Hospital, Madurai, for further retinal management. Rather than unfolding during a single surgical day, as is the case with many surgical outbreaks, this series of 13 cases occurred over a period of 3 months. The first patient presented on 10 December 2011 after 15 days of cataract surgery. Visual acuity in the operated eye was 6/60. Examination revealed a corneal infiltrate at the site of incision, with corneal oedema and minimal exudates in the anterior chamber. There was no view of the fundus; ultrasonography revealed vitreous exudates and thickening of the retina-choroid complex. Within 3 months, 12 additional patients presented with a clinical presentation suggestive of postoperative endophthalmitis (figure 1A, B). None of the 13 cases experienced intraoperative complications.

Figure1

(A) Diffuse slit-lamp biomicroscopy photograph showing extensive fibrin membrane on the intraocular lens with minimum anterior chamber reaction. (B) Diffuse slit-lamp biomicroscopy photograph showing a clear graft of one patient who had undergone patch graft of the infiltrate at the tunnel.

Furthermore, an additional 53 patients presented with a corneal tunnel infiltrate only at the site of the incision. These patients did not develop endophthalmitis. These patients were also operated in the same facility during the same period using the same batch of local anaesthetic eye drops. As these patients did not develop any signs of endophthalmitis and had only the infiltrate at the site of corneal section, they were not included in this analysis.

The average age of these 13 patients was 57.7 years (range 39–70 years), with five male and eight female patients. The median interval between surgery and diagnosis of endophthalmitis was 46.3 days (range 13–92 days). The presenting logMAR visual acuity after the development of endophthalmitis ranged from 0.48 to 2.60, (average 1.69 (SD 0.89)). Mean follow-up was 10.15 months (SD 2.88), ranging from 5 to 14 months. Nine (69%) patients out of thirteen had a final visual acuity of 6/60 or better. The logMAR vision at the last follow-up was 0.30–2.30 with average of 1.23 (SD 0.71). Among the remaining four patients, three had a vision of perception of light and one had final vision of 1/60. Table 1 describes the clinical presentation of all 13 patients.

Table 1

Demographics, clinical characteristics and outcomes in patients with Burkholderia cepacia endophthalmitis

In the remaining four patients, the infiltrate in the tunnel section persisted at the last follow-up and the graft had failed. Figure 1B shows the representative picture of one patient who had undergone a patch graft that was clear at the last follow-up. One eye progressed to phthisis bulbi. A combination of piperacillin/tazobactam intravitreal injection was utilized for such cases. Silicone oil was removed after an average of 6 months. Bacterial cultures showed positive growth identified as Bcc in all 13 patients. The isolates were resistant to all the antibiotics, except cefotaxime, piperacillin and tazobactam.

Among all the samples collected from the operating room, smears and cultures were negative for all other surveillance samples expect the eye drops that grew Bcc with the same antibiotic susceptibility pattern as that of the patients. After the source was identified as the local anaesthetics eye drops, new unopened bottles from the hospital pharmacy were examined and also grew B. cepacia with the similar antibiotic susceptibility profile.

All the isolates were confirmed as B. cepacia by the API system. Bi-directional sequencing of two isolates further confirmed that these were B. cepacia. (The GenBank accession number for Burkholderia is seq1 KC819272 and for the second isolate, seq2 KC819273.) Figure 2 shows the banding patters of 10 clinical isolates (lanes 1–10) and three isolates from eye drops (lanes A–C) (patients 11–13 not shown). Genetic analysis of the Bcc strains revealed four different BOX-PCR patterns of Bcc isolated from patients and eye drop solution. Samples 1, 6, 7, 4 and eye drop C showed pattern 1. Samples 2 and 5 showed pattern 2. Samples 3 and 10 showed pattern 3. Samples 8, 9 and B from eye drops showed pattern 4. Although sample A from the eye drops showed a single band, this was still picked up by the software as a unique pattern within the Bcc falling within pattern 4.

Figure 2

Box PCR result: BOX-PCR patterns of Burkholderia cepacia complex isolated from patients and eye drops. Lane 1–10: Burkholderia isolates from patients and lanes A–C from eye drops (patients 11–13 not shown). M: 100 bp marker. Four different BOX-PCR patterns of B. cepacia complex isolated from patients and eye drop solution were seen. Sample 1, 6,7, 4 and eye drop C showed pattern 1. Samples 2 and 5 showed pattern 2. Samples 3 and 10 showed pattern 3. Samples 8, 9, and B from eye drops showed pattern 4. Although sample A from the eye drops showed a single band, this was still picked up by the software as a unique pattern within the B. cepacia complex falling within pattern 4.

No further cases of postoperative endophthalmitis have occurred after the identification of the source of the contamination and discontinuation of the eye drops in that hospital. Ophthalmologists in India were notified of this outbreak through the All India Ophthalmology Association. Although the concerned company was informed of this outbreak, we are not aware whether there was any recall of the product from the market by the company.

Discussion

Cluster endophthalmitis has been reported in the literature, the majority of which is due to Pseudomonas sp. with very poor visual outcome.2 ,22 In this study, we report cluster endophthalmitis occurring at a single facility that was traced to eye drops contaminated with B. cepacia. There were no reports from any other eye centres in India that may have used the same batch of eye drop.

A variety of perioperative and intraoperative sterile products have been linked to cluster endophthalmitis. Ramappa et al reported an outbreak of P. aeruginosa endophthalmitis in which the source was identified from intraocular lens solutions.2 Intrinsically contaminated ophthalmic solutions, such as balanced salt solution, hyaluronic acid, Trypan blue, miochol, internal fluid pathways of a phacoemulsification unit and a contaminated phacoemulsification hand piece, have all been implicated.3–5 ,23 Akçakaya et al have reported an outbreak of Cellulosimicrobium cellulans and Stenotrophomonas maltophilia in which the S. maltophilia were also isolated from unused bottles of irrigating solutions.23 Nevertheless, it can often be challenging to pin the source of infection despite extensive environmental surveillance.

The association of the outbreak with Bcc is of particular importance as products contaminated with this pathogen have caused nosocomial outbreaks in healthcare facilities. Such outbreaks have been traced to contaminated respiratory therapy devices, medications and mouthwash.9–12 Lucero et al reported identification of tap water from hospital sinks as the likely mode of transmission in ventilated paediatric patients.15 It is well known that B. cepacia can exist in water. A recent analysis by Jimenez et al of contaminated pharmaceutical products revealed that Pseudomonas sp., Burkholderia sp. and Ralstonia picketti were the predominant pathogens, often due to lack of sterility assurance.24 Of concern, this organism has demonstrated growth in povidone iodine solutions.8 Therefore, although povidone iodine prophylaxis is currently a gold standard for preventing postcataract endophthalmitis, it may be limited in its use against Bcc infection.

Cluster endophthalmitis is often associated with a poor outcome. In our series, although the infections persisted for nearly over a year, ultimately there was resolution of the endophthalmitis and nearly 70% of patients regained functional vision. The time of presentation was an average of 46.9 days with a wide range of 13–92 days, demonstrating the slow-growing nature of this organism and delayed presentation of disease.

At the time of surgery, topical anaesthetic eye drops are repeatedly placed onto the ocular surface. Application of povidone iodine into the conjunctiva sac and washing with irrigating solution may not be adequate to completely remove the anaesthetic. In fact, the practice of the operating surgeon in these cases was to apply additional anaesthetic eye drops before the incision was placed, effectively increasing the microbial load at the tunnel site. We believe the load of the inoculum must have been high to cause such an outbreak and also affect so many patients. This process is significant given that a majority of cataract surgeries are now done under topical anaesthesia and include use of anaesthetic eye drops.

Although selective media are available for growing Burkholderia, these organisms grow well on routine blood agar. Laboratory personnel must be careful however in the recognition and identification of this pathogen. Growth is slow and colonies appear tiny in size; these could be misidentified by those not familiar with Burkholderia. The number of species within the Burkholderia species complex has now been established to 18 with the work by Peeters et al identifying Burkholderia pseudomultivorans sp. nov, a novel Bcc species from human respiratory samples.25 BOX-PCR fingerprinting was used for comparison of isolates of the same species, which showed that the isolates from the patients and the eye drops solution revealed matching banding patterns in BOX-PCR. BOX-PCR fingerprinting has the advantage of being a more rapid method that is of particular use in outbreaks.20 Although other techniques like either pulsed field gel electrophoresis (PFGE) or multilocus sequence typing maybe more reliable methods for finger printing, BOX-PCR is an equally reliable technique. Since this was a sudden outbreak and we wanted to quickly establish the clonal relationship of the strains from the eye drops to that of the patient’s samples, we selected to do BOX-PCR. Studies have shown good correlation between PFGE and BOX-PCR, and, moreover, BOX-PCR is a more rapid and less expensive method.20

There is only one report in the literature of a series of Bcc endophthalmitis. Sachdeva et al16 described 14 cases of Burkholderia over a 5-year period, representing only 1.8% of total endophthalmitis cases from their institute. It was found to occur mainly among acute-onset postoperative cases. These patients had a poor outcome, but in contrast to our isolates, these isolates were sensitive to additional antibiotics like ceftazidime and ciprofloxacin and 50% to amikacin. Our isolates demonstrated resistance to all antibiotics expect to cefotaxime and piperacillin/tazobactam. Persistence of infections is very common with this organism due to its intrinsic multidrug resistance nature. This was also found in the case series reported by Sachdeva et al.16 In our series also, the disease period was prolonged, but nearly 70% of the patients recovered good vision. We believe this could have been due to the close follow-up of these patients, use of silicone oil during the time of vitrectomy and using the combination antibiotic piperacillin/tazobactam both intravitreally and topically.

Sometimes even extensive environmental investigations will not reveal the source of the organism. This would be true in the majority of the instances of cluster infections. Maltezou et al reported postcataract surgery endophthalmitis outbreak caused by multidrug-resistant P. aeruginosa; however, the source could not be identified.5 We were fortunate in identifying the source as the same batch of eye drops was still in use at the time of investigations.

In conclusion, Bcc is a well-known opportunistic pathogen causing outbreaks associated with healthcare-related products. This is the first report of postcataract cluster endophthalmitis caused by contaminated local anaesthetic eye drops. Presterile consumables may be prone to contamination due to breach of sterility and the ophthalmologist must be aware of this possibility. Due to the persistent nature of this organism, long periods of follow-up are needed. Contrary to the poor outcome associated with these types of organisms, patients experienced relatively good visual recovery at 1 year.

References

Footnotes

  • Contributors LP: conception and design, or analysis and interpretation of data; drafting the article or revising it critically for important intellectual content; and final approval of the version to be published. MD: analysis and interpretation of data. PSP: collection of data; analysis and interpretation of data. RK: analysis and interpretation of laboratory investigation. MG: analysis and interpretation of laboratory investigation. JLP: analysis and interpretation of laboratory investigation. KNB: analysis and interpretation of data.

  • Competing interests None.

  • Ethics approval Institutional Ethics Committee of Aravind Eye Hospital.

  • Provenance and peer review Not commissioned; externally peer reviewed.