Table 1

Primer sequences, deletion, and target information: all PCR targets and deletion sites are given as nucleotide positions from the cited Genbank sequence. The a primer in each case was synthesised with a 5′ fluorophore attached (fluorophores are those marketed by ABI Applied Biosystems Ltd)

Target Accession No PCR product Deletion site Primer sequence (5′–3′) Fluorophore
HPRT M31642 407–566537–541(a) GACCAGTCAACAGGGGACAT
(b) CGACCTTGACCATCTTTGGA
Hex
IL-1α M28983 496–670521–525(a) GCTGCTGCATTACATAATCTGG
(b) TGGGTATCTCAGGCATCTCC
Fam
IL-1β M15330 83–182153–157(a) AGCCATGGCAGAAGTACCTG
(b) CATCTGTTTAGGGCCATCAG
Hex
IL-6 M14584 188–332212–216(a) AGGTTGTTTTCTGCCAGTGC
(b) CACACAGACAGCCACTCACC
Fam
IL-8 M26383 36–253222–226(a) AAGAAACCACCGGAAGGAAC
(b ) TGTGGTCCACTCTCAATCACTC
Fam
IL-12 M65272 835–963862–866(a) CCACATTCCTACTTCTCCCTGA
(b) GCTAATGCTGGCATTTTTGC
Tet
TNFα X01394 284–512306–310(a) CACCACGCTCTTCTGCCT
(b) TCTCAGCTCCACGCCATT
Fam
IFNγ M29383 501–642524–528(a) TGACTTGAATGTCCAACGCAAAG
(b) GCAGGACAACCATTACTGGGATG
Tet