Table 1 Sequencing primers and MPLA probes
Sequencing primers
Fragment 1 forward5′AGTCCCGGCCGGGCCGAG
Fragment 1 reverse5′CATGAGCGTCTTGGTTTTCC
Fragment 2 forward5′GAAGGAGCACCCGGATTAT
Fragment 2 reverse5′GAACCCATGGAGC CAAGA
Fragment 3 forward5′ACCAGCTCGCAGACCTACAT
Fragment 3 reverse5′CCCATTTCCCTCGTTTTTCT
MLPA probes
5′ left5′GGGTTCCCTAAGGGTTGGAACAGCCCGGACCGCGTCAAGCGGC
5′ right5′CCATGAATGCCTTCATGGTGTGGTTTTATAAATGTCTAGATTGGATCTTGCTGGCAC
3′ left5′GGGTTCCCTAAGGGTTGGACTGGCATGGCTCTTGGCTC CATGG
3′ right5′GTTCGGTGGTCAAGTCCGAGGCCAATCTTGATTTTTTCACAACTCTAGATTGGATCTTGCTGGCAC